Copyright©2018 CSIR-Institute of Genomics and Integrative Biology | VS Lab |
circRNA3046 | |||
Gene | n/a | Organism | Human |
Genome Locus | n/a | Build | hg19 |
Disease | Herpes Simplex Virus 1 Infection | ICD-10 | Viral infection of unspecified site (B34) |
DBLink | Link to database | PMID | 29972822 |
Experimental Method | |||
Sample Type | Cell Lines | Comparison | Human fibroblast KMB17 strain (Institute of Medical Biology, CAMS, Kunming, China), a normal diploid cell line that originated from fetal lung tissue |
Method for Estimation | Quantitative PCR and Microarrays | PCR Details | |
Primers (Experimented) | Forward CACTCAGGCACCTTCCAC ReverseTGAATCATCAGATGGTCCTC | Statistics | Fold Change : Upregulated pvalue : p<0.05 |
Citation | |||
Shi, J, Hu, N, Mo, L, Zeng, Z, Sun, J, Hu, Y (2018). Deep RNA Sequencing Reveals a Repertoire of Human Fibroblast Circular RNAs Associated with Cellular Responses to Herpes Simplex Virus 1 Infection. Cell. Physiol. Biochem., 47, 5:2031-2045. |